Everything below concerns somatotroph. We keep the language plain, cite what the science says, and separate well-supported claims from open questions.
Last reviewed on 2026-05-07. Where a claim depends on a specific study, the study is described rather than over-claimed.
CJC-1295 is a synthetic peptide modeled on growth hormone-releasing hormone, the hypothalamic signal that prompts the pituitary to release growth hormone. Its sequence corresponds to the first twenty-nine residues of human GHRH, with four substitutions that slow enzymatic breakdown. Early descriptions placed the compound in research on growth hormone deficiency and related conditions, and later literature groups it with the long-acting GHRH analogs. The name appears in both laboratory and popular fitness writing, where it sometimes labels chemically different peptides.
Two related peptides circulate under the CJC-1295 label, and they differ mainly in how long they persist in circulation. The version carrying a drug affinity complex includes a maleimidopropionic acid linker that forms a covalent bond with serum albumin. The other version, usually written as modified GRF(1-29) or tetrasubstituted GRF(1-29), lacks that linker and is cleared quickly. Mixing the two produces inconsistent readings of published half-life values, because the linker rather than the receptor-facing sequence drives most of the difference.
The core sequence keeps the receptor-binding region of GHRH while replacing four positions that are vulnerable to dipeptidyl peptidase-4 and other proteases. Substitutions at positions 2, 8, 15, and 27 raise metabolic stability relative to the natural hormone. The N-terminal residues remain essential for activity, so changes there generally lower potency. Molecular weight sits near 3368 daltons for the tetrasubstituted analog without the linker, while the albumin-binding form is heavier because of the added maleimide group.
CJC-1295 belongs to a family of synthetic peptides modeled on growth hormone-releasing hormone, the hypothalamic signal that prompts the pituitary to release growth hormone. The compound is built from the first twenty-nine amino acids of the natural human sequence, a fragment that retains full receptor binding capacity. Native growth hormone-releasing hormone is degraded quickly in circulation, so the fragment alone has limited practical value. Early work therefore focused on chemical modifications that preserve receptor binding while slowing enzymatic breakdown. The result is a molecule described in the literature as a long-acting analog of the natural hormone.
| Property | Value | Notes |
|---|---|---|
| Class | Synthetic peptide | GHRH receptor agonist |
| Sequence length | 29 amino acids | Derived from human GHRH |
| Molecular weight | About 3368 Da without linker | Albumin-binding form is heavier |
| Appearance | White to off-white lyophilized powder | Common form for research reference material |
| Typical storage | -20 °C or below, desiccated | Protect powder from light and moisture |
The dividing feature between the two forms is a maleimide-based drug affinity complex, abbreviated DAC. In the DAC-bearing version, a linker attaches the peptide to serum albumin after administration, and that association slows removal from plasma. The version lacking DAC appears in catalogs as MOD GRF(1-29) or tetrasubstituted GRF(1-29). Because informal writing treats both as one item, comparisons drawn from such sources routinely blend measurements taken from two molecules with substantially different behavior.
Four amino acid substitutions separate the modified backbone from the parent GRF(1-29) sequence. These changes reduce recognition by dipeptidyl peptidase IV and related proteases, extending the interval before degradation. Development work in this area sought longer-acting GHRH analogs for endocrine investigation. Published descriptions treat the substitution set as a defining property of the core sequence, while the albumin-binding linker is described separately as an optional addition to that same backbone.
Binding of the peptide to the growth hormone-releasing hormone receptor on pituitary somatotrophs triggers a G protein coupled cascade that raises cyclic AMP and opens calcium channels. The result is greater secretion of growth hormone into the bloodstream. Because the peptide acts at the same receptor as the natural hypothalamic hormone, its effect is amplified pulse size rather than an entirely separate release pathway. Receptor binding alone does not determine the response, since somatostatin tone and other inputs modulate the final output.
The albumin-binding version stays in circulation for days, because covalent attachment to serum albumin shields the peptide from rapid filtration and degradation. Reported half-lives for this form fall in the range of several days. The version without the linker is cleared in minutes, with estimates often near thirty minutes in animal work. These figures come from small studies and vary with assay method, species, and route, so they are best read as approximate rather than fixed constants.
Studies in this area generally track growth hormone pulses, insulin-like growth factor 1 concentrations, and occasionally body composition endpoints. Most published human data come from early, small trials, and questions about long-term effects remain open. Whether repeated exposure alters pituitary responsiveness over time is not settled. Analytical work relies on immunoassays for the hormones and on mass spectrometry for the peptide itself, because the two measurements answer different questions.
The two variants differ dramatically in how long they persist in circulation. The form lacking the albumin-binding group has a plasma half-life measured in tens of minutes, comparable to the natural hormone fragment. The version carrying the drug affinity complex binds albumin and shows a half-life of roughly six to eight days in human studies. That figure comes from small trials that tracked hormone levels over extended periods. The physiological consequences of sustained versus pulsatile stimulation are still debated and the literature does not settle the point.
Lyophilized peptide powder is comparatively stable when kept dry, cold, and protected from light. Once dissolved, the molecule is vulnerable to deamidation, oxidation, and aggregation, with the rate depending on pH, buffer composition, and temperature. Alkaline conditions and repeated freeze-thaw cycles accelerate loss of the intact peptide. The methionine present in the native sequence is a known oxidation site, which is one reason it was replaced in the modified fragment. Suppliers typically recommend cold storage of solutions and use within a short window.
Analytical confirmation usually relies on reversed-phase high-performance liquid chromatography for purity and on liquid chromatography coupled to mass spectrometry for identity. Mass data reveal the expected molecular mass and can flag truncated or oxidized species. Amino acid analysis and peptide mapping provide sequence-level verification. Immunoassays are used in some biological matrices, but antibodies raised against one releasing-hormone analog may cross-react with another. Reported purity figures depend heavily on the method used, so comparisons between suppliers require matching the analytical approach.
H–D exchange has been used to characterize protein structures and protein–protein interactions. The exchange reaction needs to be carried out with the isolated proteins and with the complex. The exchanging regions are then compared. If a region is buried by the binding, the amides in this region may be protected in the complex and exchange slowly. However, one must bear in mind that H–D exchange cannot be used to locate binding interfaces for all protein-protein interactions. Some protein-protein interactions are driven by electrostatic forces of side chains and are unlikely to change the exchange rate of backbone amide hydrogens, particularly if the amide hydrogens are located in stable structural elements such as alpha helices. Lastly, H–D exchange can be used to monitor conformational changes in proteins as they relate to protein function. If conformation is altered as result of post-translational modification, enzyme activation, drug binding or other functional events, there will likely be a change to H/D exchange that can be detected.
Shelf life is the length of time that a commodity may be stored without becoming unfit for use, consumption, or sale. In other words, it might refer to whether a commodity should no longer be on a pantry shelf (unfit for use), or no longer on a supermarket shelf (unfit for sale, but not yet unfit for use). It applies to cosmetics, foods and beverages, medical devices, medicines, explosives, pharmaceutical drugs, chemicals, tyres, batteries, and many other perishable items. In some regions, an advisory best before, mandatory use by or freshness date is required on packaged perishable foods. The concept of expiration date is related but legally distinct in some jurisdictions.
Raw feeding is the practice of feeding domestic dogs, cats and other animals a diet consisting primarily of uncooked meat, edible bones, and organs. The ingredients used to formulate raw diets can vary. Some pet owners choose to make homemade raw diets to feed their animals but commercial raw food diets are also available. Frozen, or fresh-prepared, meals come in raw or cooked form, some of which is made with ingredients that are inspected, approved, and certified by the USDA for human consumption, but formulated for pets. Part of this growing trend is the commercialization of home-made dog food for pet owners who want the same quality, but do not have the time or expertise to make it themselves. The advantage is forgoing the processing stage that traditional dog food undergoes. This causes less destruction of its nutritional integrity. The practice of feeding raw diets has raised some concerns due to the risk of foodborne illnesses, zoonosis and nutritional imbalances. People who feed their dogs raw food do so for a multitude of reasons, including but not limited to: culture, beliefs surrounding health, nutrition and what is perceived to be more natural for their pets. Feeding raw food can be perceived as allowing the pet to stay in touch with their wild, carnivorous ancestry. The raw food movement has occurred in parallel to the change in human food trends for more natural and organic products.
Sources: en.wikipedia.org
When the rats were exposed to a bacterial substance that should induce keratitis of the cornea, the amount of inflammation in the treatment group of rats (received the eye drops after exposure) was inhibited. Magnetic nanoparticles have also been used in hyperthermic therapy of cancer, cell purification, biosensing, and immunocytochemical tests.
The football team began at The University of Arizona in 1899 under the nickname "Varsity" (a name kept until the 1914 season when the team was deemed the "Wildcats"). The football team was notably successful in the 1990s, under head coach Dick Tomey; his "Desert Swarm" defense was characterized by tough, hard-nosed tactics. In 1993, the team had its first 10-win season and beat the University of Miami Hurricanes in the Fiesta Bowl by a score of 29–0. It was the bowl game's only shutout in its then 23-year history. In 1998, the team posted a school-record 12–1 season and made the Holiday Bowl in which it defeated the Nebraska Cornhuskers. Arizona ended the season ranked 4th nationally in the coaches and API poll. The 1998 Holiday Bowl was televised on ESPN and set the now-surpassed record of being the most-watched bowl game in the network's history. From November 2003 until October 2011, the program was led by Mike Stoops, brother of Bob Stoops, the head football coach at the University of Oklahoma (the 2000 BCS national champions); Stoops was fired on October 10, 2011. Former Michigan and West Virginia head coach Rich Rodriguez was hired on November 21, 2011, to lead the Wildcats. The announcement was made by UA athletic director Greg Byrne via Twitter. In his first season, Rodriguez took the Wildcats to the 2012 New Mexico Bowl, where they defeated the University of Nevada Wolf Pack. In his third season, the Wildcats won the Pac-12 South and played in the 2014 Fiesta Bowl.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
The religious beliefs and practices associated with the shroud predate historical and scientific discussions and have continued in the 21st century, although the Catholic Church has never passed judgment on its authenticity. An example is the Holy Face Medal bearing the image from the shroud, worn by some Catholics. Indeed, the Shroud of Turin is respected by Christians of several traditions, including Baptists, Catholics, Lutherans, Methodists, Greek Orthodox, Pentecostals and Presbyterians. Several Lutheran parishes have hosted replicas of the Shroud, for didactic and devotional purposes.
Sources: en.wikipedia.org
Terahertz metamaterials interact at terahertz frequencies, usually defined as 0.1 to 10 THz. Terahertz radiation lies at the far end of the infrared band, just after the end of the microwave band. This corresponds to millimeter and submillimeter wavelengths between the 3 mm (EHF band) and 0.03 mm (long-wavelength edge of far-infrared light).
=== 22 February === The SAF and the Sudan Shield Forces claimed to have forced the RSF to retreat from the Soba neighbourhood of eastern Khartoum and retook the Al-Lulua and Al-Samra neighbourhoods southeast of the Soba Bridge connecting Khartoum's southern and eastern neighbourhoods with the rural areas of East Nile, adding that the 17 RSF militants were killed while nine vehicles were destroyed or captured.
The Research Quality Association (RQA) is a not for profit membership association. Formerly known a Quality Assurance Group UK (QAG UK) and the British Association of Research Quality Assurance (BARQA), the association changed its name to RQA in December 2012 in order to be able to act in a more global role.
Sources: en.wikipedia.org
Natural GHRH is degraded quickly by dipeptidyl peptidase-4 and related enzymes, giving it a half-life measured in minutes. CJC-1295 carries substitutions that slow that breakdown, so it stays intact longer. Both act at the same pituitary receptor and produce the same class of signal.
The label was first attached to the albumin-binding form during early development work. A shorter analog without the linker later became known by the same name in informal use. Published papers normally state which version was studied, so the methods section resolves the ambiguity.
It is a synthetic peptide rather than a steroid, and it does not occur naturally in the body. Its sequence is derived from a hypothalamic hormone called growth hormone-releasing hormone. It works as a receptor agonist rather than as a replacement for that hormone.
No. It is a laboratory-synthesized analog built on a fragment of the natural hormone. The natural peptide is shorter-lived and lacks the stabilizing substitutions found in the synthetic version.